| Internal ID | 18502122 | Source Database | TransTermHP TERM 1411 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1411
|
| Sequence |
CCGGGGCCGCTTTGCGGCCCCGC Look for more occurrences |
| Start | 6164790 |
| End | 6164812 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas mosselii SJ10, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGTAACGTGACACAT(5' tail) CCGGGGCCGC(5' stem) TTT(loop) GCGGCCCCGC(3' stem) TTTTTGTTCTCAACC(3' tail). Confidence: 100. opp_overlap 6164789, overlap 6164791 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|