| Internal ID | 18484655 | Source Database | TransTermHP TERM 926 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 926
|
| Sequence |
CGCGCGGCCCGTGGGCCGCGTG Look for more occurrences |
| Start | 4699812 |
| End | 4699833 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1H2O. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTCTGAAGCTTCCGT(5' tail) CGCGCGGCC(5' stem) CGTG(loop) GGCCGCGTG(3' stem) TTTTTTCCGGGACAG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|