| Internal ID | 18478463 | Source Database | TransTermHP TERM 63 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 63
|
| Sequence |
GGGCATGGAACTCCATTTCCATGCCC Look for more occurrences |
| Start | 194382 |
| End | 194407 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14842 AZPAE14842_contig_15, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCATTCAGCCGACAA(5' tail) GGGCATGGAA(5' stem) CTCCAT(loop) TTCCATGCCC(3' stem) TTTGTTTTTATCCCG(3' tail). Confidence: 100. opp_overlap 194382 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|