| Internal ID | 18440080 | Source Database | TransTermHP TERM 29 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 29
|
| Sequence |
GAACCCCGGCTCATGGCCGGGGTTC Look for more occurrences |
| Start | 93473 |
| End | 93497 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14879 AZPAE14879_contig_14, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAATCAGGAACGAA(5' tail) GAACCCCGGCT(5' stem) CAT(loop) GGCCGGGGTTC(3' stem) TTCGTTCCATCTCAG(3' tail). Confidence: 93. opp_overlap 93469 93465 93473 93476, overlap 93469 93476 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|