| Internal ID | 18436526 | Source Database | TransTermHP TERM 85 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 85
|
| Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
| Start | 346366 |
| End | 346385 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14882 AZPAE14882_contig_32, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGAATACGACGAAAA(5' tail) GGCTCACC(5' stem) TCCG(loop) GGTGGGCC(3' stem) TTTTTGCTTTCCGCC(3' tail). Confidence: 100. opp_overlap 346366 346360, overlap 346360 346359 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|