Internal ID | 18436310 | Source Database | TransTermHP TERM 18 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 18
|
Sequence |
GAAGGGGCTGCACGCCCCTTC Look for more occurrences |
Start | 75201 |
End | 75221 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14882 AZPAE14882_contig_23, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TCCTGCTCGGCAAAA(5' tail) GAAGGGGC(5' stem) GTGCA(loop) GCCCCTTC(3' stem) CTTCCCATGGATCAC(3' tail). Confidence: 91. opp_overlap 75204, overlap 75204 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|