| Internal ID | 18433726 | Source Database | TransTermHP TERM 18 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 18
|
| Sequence |
GAATGACTGGAAACAGGCATTC Look for more occurrences |
| Start | 65887 |
| End | 65908 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14884 AZPAE14884_contig_5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGTGCACGTAACGC(5' tail) GAATGACTG(5' stem) GAAA(loop) CAGGCATTC(3' stem) TTTTTGTCAGATCGC(3' tail). Confidence: 90. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|