Internal ID | 18425758 | Source Database | TransTermHP TERM 4 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 4
|
Sequence |
GCCCGAGGCCTGTGCCTCGGGC Look for more occurrences |
Start | 24271 |
End | 24292 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14891 AZPAE14891_contig_9, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGACCGATGAAAAAA(5' tail) GCCCGAGGC(5' stem) ACAG(loop) GCCTCGGGC(3' stem) TTTTCGTCACCAGCG(3' tail). Confidence: 100. opp_overlap 24271 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|