| Internal ID | 18425758 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
GCCCGAGGCCTGTGCCTCGGGC Look for more occurrences |
| Start | 24271 |
| End | 24292 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14891 AZPAE14891_contig_9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGACCGATGAAAAAA(5' tail) GCCCGAGGC(5' stem) ACAG(loop) GCCTCGGGC(3' stem) TTTTCGTCACCAGCG(3' tail). Confidence: 100. opp_overlap 24271 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|