Internal ID | 18425329 | Source Database | TransTermHP TERM 4 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 4
|
Sequence |
GGGTTCCGGCGCCAGCCGGAACCC Look for more occurrences |
Start | 58049 |
End | 58072 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14891 AZPAE14891_contig_32, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GTGTCGGATGGAAAA(5' tail) GGGTTCCGGC(5' stem) TGGC(loop) GCCGGAACCC(3' stem) CTGGGCCAGGATCAG(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|