| Internal ID | 18424872 | Source Database | TransTermHP TERM 51 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 51
|
| Sequence |
CGCCCGCCGCATCCGGCGGGCG Look for more occurrences |
| Start | 210176 |
| End | 210197 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14891 AZPAE14891_contig_14, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGCGAAAACGAAAA(5' tail) CGCCCGCCG(5' stem) GATG(loop) CGGCGGGCG(3' stem) TCGGGTCCTGCGAAT(3' tail). Confidence: 100. overlap 210159 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|