| Internal ID | 18424838 | Source Database | TransTermHP TERM 6 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 6
|
| Sequence |
GCCGGGCTAAAGCCTTCCGGC Look for more occurrences |
| Start | 35832 |
| End | 35852 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14891 AZPAE14891_contig_13, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTTCAATCAAAAAA(5' tail) GCCGGA(5' stem) AGGCTTTAG(loop) CCCGGC(3' stem) AATTCCACTCGGGCC(3' tail). Confidence: 93. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|