| Internal ID | 18418345 | Source Database | TransTermHP TERM 16 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 16
|
| Sequence |
GGCGCGGTCCGCCGCCGGGCCGCGCC Look for more occurrences |
| Start | 81557 |
| End | 81582 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE15025 AZPAE15025_contig_34, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGACGGGGGGAAAC(5' tail) GGCGCGGCCCG(5' stem) GCGG(loop) CGGACCGCGCC(3' stem) CTCGGCTTCAGCGGT(3' tail). Confidence: 90. overlap 81556 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|