| Internal ID | 18402766 | Source Database | TransTermHP TERM 37 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 37
|
| Sequence |
GGCGAAGCCATCCGGCTTCGCC Look for more occurrences |
| Start | 124985 |
| End | 125006 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE15026 AZPAE15026_contig_2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGCGTGGAGAAAAAA(5' tail) GGCGAAGCC(5' stem) ATCC(loop) GGCTTCGCC(3' stem) TTTTTCGTTTCTGCG(3' tail). Confidence: 100. opp_overlap 124985 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|