Internal ID | 18401444 | Source Database | TransTermHP TERM 81 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 81
|
Sequence |
GAACCCCGGCTCATGGCCGGGGTTC Look for more occurrences |
Start | 366186 |
End | 366210 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14945 AZPAE14945_contig_9, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCAATCCGTAACGAA(5' tail) GAACCCCGGCT(5' stem) CAT(loop) GGCCGGGGTTC(3' stem) TTCGTTCCATCGCAG(3' tail). Confidence: 93. opp_overlap 366186 366189, overlap 366182 366189 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|