| Internal ID | 18389549 | Source Database | TransTermHP TERM 15 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 15
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 39918 |
| End | 39942 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14955 AZPAE14955_contig_13, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAATCAGGAACGAA(5' tail) GAACCCCGGC(5' stem) TCATG(loop) GCCGGGGTTC(3' stem) TTCGTTCCATCGCAG(3' tail). Confidence: 93. opp_overlap 39918 39914 39921, overlap 39914 39910 39921 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|