| Internal ID | 18389543 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
| Start | 25893 |
| End | 25918 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14955 AZPAE14955_contig_13, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCCCACACCGCAAG(5' tail) C-AAGCCCCGC(5' stem) AATTG(loop) GCGGGGCTTCG(3' stem) TTTTTCCGGGGGCCA(3' tail). Confidence: 95. gap 1, opp_overlap 25896, overlap 25896 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|