Internal ID | 18383367 | Source Database | TransTermHP TERM 6 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 6
|
Sequence |
TCCGCGTTAAACTGCGCGGG Look for more occurrences |
Start | 21448 |
End | 21467 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14963 AZPAE14693_contig_18_Average_coverage:_105.25, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCGTGACCGCCAAT(5' tail) TCCGCGT(5' stem) TAAACT(loop) GCGCGGG(3' stem) TTTTTTCCTCTCTCC(3' tail). Confidence: 93. overlap 21449 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|