| Internal ID | 18383323 | Source Database | TransTermHP TERM 9 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 9
|
| Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
| Start | 16450 |
| End | 16475 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14963 AZPAE14693_contig_14_Average_coverage:_105.77, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGGCCGCCGGAAAAA(5' tail) CGAAGCCCCGC(5' stem) CAATT(loop) GCGGGGCTT-G(3' stem) CTTGCGGTGTGGACG(3' tail). Confidence: 95. gap 1, opp_overlap 16454, overlap 16454 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|