| Internal ID | 18356184 | Source Database | TransTermHP TERM 12 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 12
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 69906 |
| End | 69930 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14988 AZPAE14988_contig_16, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAATCCGTAACGAA(5' tail) GAACCCCGGC(5' stem) TCATG(loop) GCCGGGGTTC(3' stem) TTCGTTCCATCGCAG(3' tail). Confidence: 91. opp_overlap 69906 69902 69909, overlap 69909 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|