| Internal ID | 18355927 | Source Database | TransTermHP TERM 28 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 28
|
| Sequence |
GGCCCGGCTAGAAGACCGGGCC Look for more occurrences |
| Start | 104391 |
| End | 104412 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14988 AZPAE14988_contig_1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCACTGAAACGAAAA(5' tail) GGCCCGGTCT(5' stem) TCT(loop) AG-CCGGGCC(3' stem) TTTGCCGTTGTGGCG(3' tail). Confidence: 100. gap 1, opp_overlap 104391, overlap 104386 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|