| Internal ID | 18349660 | Source Database | TransTermHP TERM 2 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 2
|
| Sequence |
GAACGCCGGCTATCGCCGGCGTTC Look for more occurrences |
| Start | 2220 |
| End | 2243 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14996 AZPAE14996_contig_48, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGGGGCTAGACGCAG(5' tail) GAACGCCGGC(5' stem) TATC(loop) GCCGGCGTTC(3' stem) TTGTTTGCGCGTTCC(3' tail). Confidence: 95. opp_overlap 2223, overlap 2217 2223 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|