| Internal ID | 18323806 | Source Database | TransTermHP TERM 4 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 4
|
| Sequence |
GCCCGAGGCACAGTCCTCGGGC Look for more occurrences |
| Start | 24545 |
| End | 24566 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE15022 AZPAE15022_contig_24, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGACCGATGAAAAAA(5' tail) GCCCGAGG(5' stem) CACAGT(loop) CCTCGGGC(3' stem) TTTTCGTCACCAGCG(3' tail). Confidence: 95. opp_overlap 24545 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|