Internal ID | 18320426 | Source Database | TransTermHP TERM 21 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 21
|
Sequence |
GCGAAGCCATTGATTTGGCTTCGC Look for more occurrences |
Start | 41931 |
End | 41954 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE15055 AZPAE15055_contig_10, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGTAAACATTAGAA(5' tail) GCGAAGCCA(5' stem) TTGATT(loop) TGGCTTCGC(3' stem) TTTTTTATTGTTTAC(3' tail). Confidence: 100. opp_overlap 41931 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|