Internal ID | 18302588 | Source Database | TransTermHP TERM 45 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 45
|
Sequence |
CGCCGGGCATCAGCCCGGCG Look for more occurrences |
Start | 199031 |
End | 199050 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE15033 AZPAE15033_contig_2, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GTGCGCAATGAAAAA(5' tail) CGCCGGGC(5' stem) ATCA(loop) GCCCGGCG(3' stem) TTTTCGTTTCCGCCT(3' tail). Confidence: 100. opp_overlap 199031, overlap 199026 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|