Internal ID | 18302345 | Source Database | TransTermHP TERM 45 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 45
|
Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
Start | 134278 |
End | 134297 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE15033 AZPAE15033_contig_10, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCGGAAAGCAAAAA(5' tail) GGCCCACC(5' stem) CGGA(loop) GGTGAGCC(3' stem) TTTTCGTCGTATTCA(3' tail). Confidence: 100. opp_overlap 134272 134278, overlap 134272 134271 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|