Internal ID | 18285686 | Source Database | TransTermHP TERM 80 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 80
|
Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
Start | 250069 |
End | 250088 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14935 AZPAE14935_contig_4, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGCGGAAAGCAAAAA(5' tail) GGCCCACC(5' stem) CGGA(loop) GGTGAGCC(3' stem) TTTTCGTCGTATTCA(3' tail). Confidence: 100. opp_overlap 250063 250069, overlap 250063 250062 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|