| Internal ID | 18285685 | Source Database | TransTermHP TERM 76 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 76
|
| Sequence |
CGGGGCGGCTATAATCGCCGCCCCG Look for more occurrences |
| Start | 245181 |
| End | 245205 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14935 AZPAE14935_contig_4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGGCAGCGGGAAAA(5' tail) CGGGGCGGCGA(5' stem) TTA(loop) TAGCCGCCCCG(3' stem) CAGGCATCGGAAAGC(3' tail). Confidence: 100. overlap 245197 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|