| Internal ID | 18233571 | Source Database | TransTermHP TERM 44 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 44
|
| Sequence |
GAACCCCGGCTCATGGCCGGGGTTC Look for more occurrences |
| Start | 179547 |
| End | 179571 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE13757 AZPAE13757_contig_13, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAATCAGGAACGAA(5' tail) GAACCCCGGCT(5' stem) CAT(loop) GGCCGGGGTTC(3' stem) TTCGTTCCATCTCAG(3' tail). Confidence: 93. opp_overlap 179543 179539 179547 179550, overlap 179543 179550 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|