| Internal ID | 18219975 | Source Database | TransTermHP TERM 1 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1
|
| Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
| Start | 12495 |
| End | 12520 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14359 AZPAE14359_contig_42, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGTCCACACCGCAAG(5' tail) C-AAGCCCCGC(5' stem) AATTG(loop) GCGGGGCTTCG(3' stem) TTTTTCCGGCGGCCA(3' tail). Confidence: 93. gap 1, opp_overlap 12498, overlap 12498 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|