| Internal ID | 18215827 | Source Database | TransTermHP TERM 239 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 239
|
| Sequence |
GCCCGGCCATCGAGCCGGGC Look for more occurrences |
| Start | 828810 |
| End | 828829 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14373 AZPAE14373_contig_2, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCCGCAGCGAAAGA(5' tail) GCCCGGC(5' stem) CATCGA(loop) GCCGGGC(3' stem) TTTTTCGTGGGCGCG(3' tail). Confidence: 100. opp_overlap 828810 828808, overlap 828796 828796 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|