Internal ID | 18206561 | Source Database | TransTermHP TERM 5 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 5
|
Sequence |
GAACGCCCCGCAATGCGGGGCGTTC Look for more occurrences |
Start | 1695 |
End | 1719 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE14410 AZPAE14410_contig_31, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGTAGCCGAGAAGCA(5' tail) GAACGCCCCGC(5' stem) ATT(loop) GCGGGGCGTTC(3' stem) TTTTTTCGCAGCCGG(3' tail). Confidence: 100. opp_overlap 1695, overlap 1698 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|