| Internal ID | 18206559 | Source Database | TransTermHP TERM 1 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1
|
| Sequence |
AAGCCCGCCTTCAGGCGGGCTC Look for more occurrences |
| Start | 1593 |
| End | 1614 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14410 AZPAE14410_contig_31, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGTCCGTTCCGTTCA(5' tail) AAGCCCGCC(5' stem) TTCA(loop) GGCGGGCTC(3' stem) TTTGTTTCTGTACAG(3' tail). Confidence: 93. opp_overlap 1595, overlap 1595 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|