| Internal ID | 18196671 | Source Database | TransTermHP TERM 20 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 20
|
| Sequence |
CGGCGCATCCCCAACGGGATGCGCCG Look for more occurrences |
| Start | 176934 |
| End | 176959 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE14453 AZPAE14453_contig_1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AACCGCTGAAGCGTA(5' tail) CGGCGCATCCC(5' stem) CAAC(loop) GGGATGCGCCG(3' stem) TTTTCACATCGGCCG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|