| Internal ID | 18182846 | Source Database | TransTermHP TERM 113 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 113
|
| Sequence |
GAGGCCACCCTTGGGTGGCCTC Look for more occurrences |
| Start | 309508 |
| End | 309529 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE12140 AZPAE12140_contig_11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGCGGCGGAACGAA(5' tail) GAGGCCACC(5' stem) CTTG(loop) GGTGGCCTC(3' stem) TTTCATGGCGGGATG(3' tail). Confidence: 90. opp_overlap 309508 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|