| Internal ID | 18175036 | Source Database | TransTermHP TERM 20 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 20
|
| Sequence |
GGCGAAGCCATCCGGCTTCGCC Look for more occurrences |
| Start | 80102 |
| End | 80123 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE12148 AZPAE12148_contig_21, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCAGAAACGAAAAA(5' tail) GGCGAAGCC(5' stem) GGAT(loop) GGCTTCGCC(3' stem) TTTTTTTCTCCACGC(3' tail). Confidence: 100. opp_overlap 80102 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|