Internal ID | 18173258 |
Source Database | TransTermHP TERM 14 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 14
|
Sequence |
CGCCGACCCTAGGGTCGGCG Look for more occurrences |
Start | 49061 |
End | 49080 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE12151 AZPAE12151_contig_23, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCGCCATGCAAGAA(5' tail) CGCCGACC(5' stem) CTAG(loop) GGTCGGCG(3' stem) TTTTTTTATCCTCGC(3' tail). Confidence: 100. opp_overlap 49061 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|