| Internal ID | 18172742 | Source Database | TransTermHP TERM 99 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 99
|
| Sequence |
GGGGGCGCCGCATGGCGCCCCC Look for more occurrences |
| Start | 219716 |
| End | 219737 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE12153 AZPAE12153_contig_9, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGCGTAAATGACAAC(5' tail) GGGGGCGCC(5' stem) GCAT(loop) GGCGCCCCC(3' stem) TATACTTTCCGCTTT(3' tail). Confidence: 91. opp_overlap 219716 219715 219709, overlap 219711 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|