Internal ID | 18166825 | Source Database | TransTermHP TERM 14 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 14
|
Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
Start | 39866 |
End | 39890 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa strain AZPAE12411 AZPAE12411_contig_9, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCAATCAGGAACGAA(5' tail) GAACCCCGGC(5' stem) TCATG(loop) GCCGGGGTTC(3' stem) TTCGTTCCATCGCAG(3' tail). Confidence: 93. opp_overlap 39862 39866 39869, overlap 39862 39858 39869 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|