| Internal ID | 18158724 | Source Database | TransTermHP TERM 59 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 59
|
| Sequence |
GGGCGTCCTTCCGGACGCCC Look for more occurrences |
| Start | 323395 |
| End | 323414 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE12417 AZPAE12417_contig_5, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCATGATCATCTTCA(5' tail) GGGCGTCC(5' stem) TTCC(loop) GGACGCCC(3' stem) TTCTTTTATCCCCCT(3' tail). Confidence: 100. overlap 323392 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|