| Internal ID | 18158045 | Source Database | TransTermHP TERM 119 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 119
|
| Sequence |
GAACCCCGGCCATGAGCCGGGGTTC Look for more occurrences |
| Start | 402396 |
| End | 402420 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa strain AZPAE12417 AZPAE12417_contig_11, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGAGATGGAACGAA(5' tail) GAACCCCGGC(5' stem) CATGA(loop) GCCGGGGTTC(3' stem) TTCGTTCCTGATTGC(3' tail). Confidence: 93. opp_overlap 402396 402392 402399, overlap 402392 402388 402399 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|