| Internal ID | 18151724 | Source Database | TransTermHP TERM 20 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 20
|
| Sequence |
CGGCGCAGCCCCCATAGGCTGCGCCG Look for more occurrences |
| Start | 99739 |
| End | 99764 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens EGD-AQ6 contig4, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTTCTGAAACGAAAT(5' tail) CGGCGCAGCC(5' stem) TATGGG(loop) GGCTGCGCCG(3' stem) GGTGTTTTACTCGAT(3' tail). Confidence: 100. opp_overlap 99738 99737 99735, overlap 99738 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|