| Internal ID | 18146730 | Source Database | TransTermHP TERM 41 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 41
|
| Sequence |
CAAAGGCCACCTTCGGGTGGCCTTTG Look for more occurrences |
| Start | 127225 |
| End | 127250 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU10973 Scaffold_150, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGACGCTCTACCAG(5' tail) CAAAGGCCACC(5' stem) TTCG(loop) GGTGGCCTTTG(3' stem) TGCGTTTAGACGGTG(3' tail). Confidence: 95. opp_overlap 127229, overlap 127229 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|