| Internal ID | 18146574 | Source Database | TransTermHP TERM 6 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 6
|
| Sequence |
GCCCTAGGTCGTTTGAGCTGGGGC Look for more occurrences |
| Start | 67949 |
| End | 67972 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens strain AU10973 Scaffold_110, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGTACAAAAAAA(5' tail) GCCCTAGGTC(5' stem) GTTT(loop) GAGCTGGGGC(3' stem) TTTTTTTATAGTATC(3' tail). Confidence: 100. opp_overlap 67949 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|