Internal ID | 18139739 | Source Database | TransTermHP TERM 118 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 118
|
Sequence |
GGTCACAGCTTCCCAGCTGTGGCC Look for more occurrences |
Start | 577471 |
End | 577494 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas lutea strain DSM 17257 Contig002, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCTAAAACAACAAA(5' tail) GGCCACAGCT(5' stem) GGGA(loop) AGCTGTGACC(3' stem) TATAGAAAAAAACAC(3' tail). Confidence: 95. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|