| Internal ID | 18138433 | Source Database | TransTermHP TERM 160 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 160
|
| Sequence |
GCCCCGGCATTGACCGGGGC Look for more occurrences |
| Start | 661264 |
| End | 661283 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas mendocina EGD-AQ5 contig1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCGCCCATGAAAAA(5' tail) GCCCCGG(5' stem) CATTGA(loop) CCGGGGC(3' stem) TTTTTCGTTACTGCG(3' tail). Confidence: 100. opp_overlap 661264, overlap 661257 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|