| Internal ID | 18129895 | Source Database | TransTermHP TERM 1301 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1301
|
| Sequence |
CGGCGCAGCCCCCATAGGCTGCGCCG Look for more occurrences |
| Start | 6001600 |
| End | 6001625 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas simiae strain WCS417. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGAGTAAAACACC(5' tail) CGGCGCAGCC(5' stem) CCCATA(loop) GGCTGCGCCG(3' stem) ATTTCGTTTCAGAAG(3' tail). Confidence: 100. opp_overlap 6001599 6001598 6001596, overlap 6001599 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|