| Internal ID | 18125471 | Source Database | TransTermHP TERM 960 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 960
|
| Sequence |
CGTTCCCACGCTCTGCGTGGGAATG Look for more occurrences |
| Start | 4436120 |
| End | 4436144 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. WCS374. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCACCCTGTCTGAT(5' tail) CGTTCCCACGC(5' stem) TCT(loop) GCGTGGGAATG(3' stem) CTGTTTTGGACGCTC(3' tail). Confidence: 90. overlap 4436119 4436117 4436122 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|