| Internal ID | 18125291 | Source Database | TransTermHP TERM 682 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 682
|
| Sequence |
CGCCCGGGCGAGATTCGCTCGGGCG Look for more occurrences |
| Start | 3036097 |
| End | 3036121 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. WCS374. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTGCAGACAAAAAAA(5' tail) CGCCCGAGCGA(5' stem) ATC(loop) TCGCCCGGGCG(3' stem) TTTTGAGGGCGGATG(3' tail). Confidence: 100. opp_overlap 3036097 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|