Internal ID | 18125290 | Source Database | TransTermHP TERM 681 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 681
|
Sequence |
CCCCATGAGCGATCATGGGG Look for more occurrences |
Start | 3034447 |
End | 3034466 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. WCS374. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TGGGAACGAGAAAAA(5' tail) CCCCATGA(5' stem) TCGC(loop) TCATGGGG(3' stem) TTTTTCATTTTCAGC(3' tail). Confidence: 100. opp_overlap 3034447 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|