| Internal ID | 18120543 | Source Database | TransTermHP TERM 5 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 5
|
| Sequence |
CCCCGGCCTGGTTGCCGGGG Look for more occurrences |
| Start | 52181 |
| End | 52200 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa H1l COntig25, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGCAAGACAGAAAA(5' tail) CCCCGGC(5' stem) AACCAG(loop) GCCGGGG(3' stem) CAATCGTCGTCGGCG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|